CBrugiaQ_1881


Sequence

>CBrugiaQ_1881 (4 EST) Length=416 TGAGGGTATCATTTCTTGTTTGGTATGCATTANAATTGCTCGTTGAAATGCTATTTTATTCTTTTTTCAAATCGTTGGTT GGAAAAGATGTGGTGGTGGAATTGAAAAATGATCTGAGTATTTGCGGTACATTACATTCTGTTGATCAGTACCTAAATAT GAAACTGACGGATATCTCAGTGACTGATTCGGAGCGGTATCCGCATATGCTTTCCGTCAAAAACTGCTTCATTCGTGGAT CTGTTGTACGATATGTGCAGTTGCCTGCTGATCAAGTGGATACTCAGCTACTGCAGGATGCAAGTAGGAAGGAAGTTATG CAAGCCAAAAGAACCGCTACCGCCTAATTTTTTTTGTCTAACTTTATCAATTAATGACTACTTTGACTTTACTCCTACAC ATACATTTTCTCTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1881: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8196811763862AA180566MBAFCG2E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8675321849762AA228204SWMFCA1132SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9164411917061AA275426MB4SLY1D06T3Brugia malayi L4 JHU93SL-BmL4
9164601917080AA275445MB4SLY1F02T3Brugia malayi L4 JHU93SL-BmL4


Date: 5:15:8 on Tue 21 Nov 117.