CBrugiaQ_1889


Sequence

>CBrugiaQ_1889 (2 EST) Length=418 CAGTCGTTCAATACAGCATATCTTGATATAATGACGCTACTATGTACCGAGCTTTTGCTCATTTTGCCATCACTGTTTGT ATTCCATAATCCACTTGCTTCTAAAGAGTGTTGGTTAATGTTGGTTAAGGTCTAGAAAAGTTGCAGATGTTTGTTGATGT TTTGATGCGTGATTGTATTTTATTCAGTGATTAAACAACAAGTGAAGGACAGCTAATAAGATTTCCTCATAACACCCTTC TGTAACCAATTTAAGTTGTACATCATGGCGGGTAGTTGAGTCAGAAAAATAATTCGGTGTTTCTGGATGAATTGTGTAGG ACATACTGTTGAAGCCCATCATTTCGTTTTTGTGATAAGAAAGATTTGGTGTTACATATTAGTTGCATGTTACCAAAAAA TATATTCCATTTCCATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1889: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6837741550533AA057893SWMFCA888SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10751612113638AA430842RRAMCA1572SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:36:36 on Sat 18 Nov 117.