CBrugiaQ_1895


Sequence

>CBrugiaQ_1895 (24 EST) Length=453 TTTACAAACCAAGNNTNAACCTTTTANAACCCCAATTNAATTTNATTTAAATTTATTAAATNAATTAAATTNAAACCACC CCAAAAAAATNATTAAAATTTAAATTNTAGCNAANAATTTAAAAATTTTNATTCAAATTTAAAAAAAAAAAATNATAATC CAAAAAAATAAAAAACCAAAAACCAAAAAAAATAAAAACAACAAAAAAATAGCCATAATTATAATAATAATTACAGCCAG AAATACTACAAAAATAAGTTAACAAAGAAAAAATACCACTCAAAAAAATCAATACAATAAAATAAGAATATCACACATGA ACACCCAAAGAAATATAACAACTTATAAATAAAATACCTAAACATATCATGATGCAACTTTTCATAGGATCCCAATCTAA AAAACTTAAGCAAAAAAATAAAATGCCGAAATCGGCACGAAAAAAAACTAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_1895: (24 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217590808412R47525SW3ICA022SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291585902117H30961SW3ICA208SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
296566902921H35871SW3ICA203SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427301164878N41280SW3ICA1007SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445331167334N43032SW3ICA1028SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809451235914N74783SW3ICA1387SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811751237145N74836SW3ICA1370SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5014301266951N94670SWAMCA466SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5305201300270W23407RRAMCA1296SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441711318065W36319RRAMCA1349SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5596521349158W51730SWAMCA627SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801031382104W59890SWAMCA768SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6000661416489W91822SWAMCA1034SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7272421634887AA089408SW3ICA1772SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679911850756AA228650SW3ICA2060SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141241912494AA273120SW3ICA2096SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246161926218AA283524SW3ICA2653SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751572113634AA430838RRAMCA1567SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10797682140388AA435474SWAMCA1717SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10860002153584AA441706SW3ICA2523SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10901912158562AA445897SWAMCA1740SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860412660403AA680455SWAMCA3032SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860482660410AA680462SWAMCA3040SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13870582662998AA680993SW3ICA2696SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:28:24 on Mon 20 Nov 117.