CBrugiaQ_1900


Sequence

>CBrugiaQ_1900 (2 EST) Length=427 ACGTGAAAATTTATCCAACGATGTATAACAAATTAATGATAATCACTAAATACGTCTTTACTTTGGAGCCGGTGTTTTCT GAGCAGCCGTCGTCTTCCGAGCAGCCTTTTTCTTGAACTCTTTCCGACGTGAAATCTGAATCTTTTCTTCAAACGGATGT TGCGTTCCAAGCCGTCTACGATTGGTCAAAACAGCGGTACGTTTCAGTACTGCTGCATATGGATTCAACTTGACCAAGAT AGCAGATTTTTTCAATGGATTGCGATGCATCCTTGAAGTCCTGACCTTAAATATCTTTATCTTTTTCTCTCGAATGGCCT TCACAATTTCTTCGGACCGGATCAGTCGTGAGAAATCGGCATTCGCCATTTTTGCTGTCGGCATGACGAACTTAGCCTTG GCAACAGCTTTGCGAGTTTCCGTTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1900: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523431668327AA114456MBAFCE5A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620751681943AA123606MBAFCE9C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:11:59 on Sun 19 Nov 117.