CBrugiaQ_1905


Sequence

>CBrugiaQ_1905 (2 EST) Length=744 ACAGTGAATAATGTCATAGTGCATCATCCATACATCGTGTTAGTACGCTGTAGTTTGGAGATAGCTAAATCGGATATTTG AGATTTTCGATATCTCTTCTTTAATTCCTTTTCCAAGCATTCACAAGCAATATTAGTAAGCACTGGGGTGATTGTGAATA TAAACAGATTAACTTGTGTTAGGAGGTATCAGTATCGGTGTTTTTGGGCATATAACGTATGAATATGGCACAAAACACTA TTGCTATTTTGATAAGCTCGTCGGCTGCTGCTGTTTTAGTCTTTGACTTTCTCTTGTAAATTAATTTTGCATTGAGTTTT TCTGCTTAATGAAGTGAATGGCTTTGCAAAGTAAATTACCACAAGTATGAGGAAAATGTCGATGCTGGATCAACTGGAAG AGATGGGTTTCCCTCACGATGTTGCCGAAAAAGCGTTACGAGAAACCGGTGAGGCAGGGTTGATTGAGGCAGTGGAGTGG ATTGCGGCCCATCAGAAGGATGATGATATAAATCCGGCGAAACCTATTGAGCCACAATTGCCGGAAGAGGAAAGTTCGAT TATTGAATTTGCTGAAGAAGAGGAACCATCGAAACCATCATCTACTGAAGCACAGCAAGCAATGTCATTCAAATGTGATG TATGTGGAAAACAATTAGCCGACGACCAAGCTGTTATGTTCCATGCAGCACGTACAAAACATGAAGCATTTAGTGAATCA ACGGAAACTGTGAAGCCGTTAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1905: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449581172340N43457AS4SLC783T3Brugia malayi L4 JHU93SL-BmL4
13860512660413AA680465SWAMCA3045SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:14:6 on Fri 17 Nov 117.