CBrugiaQ_1913


Sequence

>CBrugiaQ_1913 (7 EST) Length=517 CAAATATCATAAAATAATAAAACACAATCGTAGTTTACATGAAGAAAATTCTGTTAAAGAAGATACAGGCTCACTGTTCA TTTGTAGCGGCTTGTTCAGGCCTCATTGCATCTGGTACAGGTGGTGGAATTGATAGAGGTTCAATGATAACGTCATCTTC TTCGTTAGCAACAACAAGTGCTAGCGGTGCCGGTGCTTGAGCACGAGAATTCTGAGGGGTATAACCACACTCCGAAAGAG TTTGACGGTCCTCAATTGTATGCCAGAAACCATCCTCGGTTTGCTTCTTCAAAATCTGCTTATTGATTGGCACCTTTAGA ATACCTTCAATTATTTTCTTAAGTTCCAAAACTGTCGCATTTTCTTTTACATCACAAAAAATATGCGTTTTACGACGCAA TATTTCAAAAAAGAGTTCCATTTTACTAGTATCCACAGATGTGGATATTTGGTCAGACATTGAGCATTACTCAATAAGTC ATACAAACGAAGTGAATGAATGAATGCTCAAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1913: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217778808600R47713AS3ISB124SLBrugia malayi infective L3 JHU93SL-BmL3
281208889965H21270AS3ISB195SLBrugia malayi infective L3 JHU93SL-BmL3
7620221681890AA123579MBAFCE8B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8809511870935AA241669MBL2SJ2F3T3Brugia malayi second stage larvae JHU96SL-BmL2
8985751893180AA257703MBAFCZ3A9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480562064703AA406737MBAFCZ3A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10988612168031AA454362MBAFCX0F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:32:42 on Mon 20 Nov 117.