CBrugiaQ_1916


Sequence

>CBrugiaQ_1916 (3 EST) Length=718 TTCATTTGAGAGTTTAATTTGAAGATTGCCGATCATATAAGTCTACGCACCGATGATAATCACTCGAACACAGAGTCAAT ACCACCATATTTGTATTGTTACAAAATGCGATGATTTGCTGAGATCCGTAGATCAAAAATTGGAGGGGAATTGAGGAAGA GCCCAAAAAAAAGTGGCTAAAAACATTTTTAATTTGGAATTGTGGGATTACTGAAGACATGGGTTATTCAAGACTGCATT CAATATGGACGATACCCTCCACGATCACCACCCCCTCGAACGCCTCTGTAAGCACCACGTTGAATTCCTCCTCGATCACC ACCACGTCCACGGAAACCGCCACGTTCTCCGCCTCGACCACCACGGAAACCTCCTCTCCCCCCTCGCATTGCTCCACCTC GTGCCGAATTCGGCACGAGCTTGGAGTGACGGCGTACGCGTGTCTGCTAACCCACAACAAGTGCTCGTCACTATCAATTC GCCTCCACTCTTAATACCTTTTATTTTCTCAATTATGTTCGTCTGCATATCACATTCCCTTCTTTCTCTTTACTTTCCCT ATTTCGTTTTTCTCTACAAATCTCGCTTCTTCCCACTTGTCCCCTCAATGACCCTTTACCTCACAGCCTAAAATGCTGAT ATTATTATCATTTTTTGAGCTATCAATTCCCAAACAGGAAAATATTTCAAAAACGTCAAAGGTGTATTACACATTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1916: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522581668242AA114372MBAFCE3A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482462064893AA406888MBAFCZ6F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668112605349AA661305MB3D6V5D02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 20:51:10 on Tue 21 Nov 117.