CBrugiaQ_1921


Sequence

>CBrugiaQ_1921 (3 EST) Length=412 GTTTGAGGGGATGTTAACTAAAAGTACTCCAATGCCCTCAGATGAGGAGCTAATAGTACCTCATGAAATCACTCTTTCAA CGCCTTACTTTAAAGCCGTTATACCATATATGCACAGAGCATGTGAGAGAGAAGTTAAAGATTTTATGTTGCGTCGACAG GAAACTGAAGATCCACGGCTTTCACTAAGAGAAGGTCAGGCTCTTACCGCATGCGGTATCAAATTTTTACAAGCACTGAA AAAGGTTTGCAATGAAAATGTTGATCGTTATGCTGATTGTATTGATCACCGTACTTCCAAACTCTACATTACACCTTGCC GTGAACAACAGCGTCGTTTGGATATTTGCGTGGAAGAAAACTTGAACATTATTCGACCAAGAGTGGGATATTTCAGCAAA TTACATGTGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1921: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291532902064H30908SW3ICA120SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8987861893391AA257875MBL2SJ4F9T3Brugia malayi second stage larvae JHU96SL-BmL2
10481672064814AA406835MBAFCZ5F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:4:6 on Sat 18 Nov 117.