CBrugiaQ_1922


Sequence

>CBrugiaQ_1922 (9 EST) Length=388 CCCANTTTGAGGGCATAGACAACAATGAGGTCATCTGTACTCAGATTCTGTGCAAAGGTCAATCAGGAAACTCTCCAAGT AAGTAGGAAGAATTTGTTCCGGATATGTGGTACTATTGTGGTCGCAGAAATAGTGCTTGCTGCGTATGTTGAAGAGTTTG CTCTGCCAACTCCAGATATGGTGTACGATTTCCACATGAGGTTTTCTCGAGAATTTGCTGATTTCGCAGTGGGCAACAAA TATGGCGCTAAAACTTCTCGTCATATTGGTGGCAAGTAAAAGATCAGAACTGATTAAATTTGGAATTATGTTACATTTCT TTCAATGCAGTTTCTAATATAAATTGATTGGTTGTGAAGCATTGGAGTTCAAATAAAAAGAAAAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1922: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449251172307N43424AS4SLC558T3Brugia malayi L4 JHU93SL-BmL4
7619681681836AA123512MBAFCE7D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8982421892847AA257371MB4SLM2A12T3Brugia malayi L4 JHU93SL-BmL4
8982801892885AA257246MB4SLM2F1T3Brugia malayi L4 JHU93SL-BmL4
8988051893410AA257635MBL2SJ4H9T3Brugia malayi second stage larvae JHU96SL-BmL2
10750912113568AA430886RRAMCA1482SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10989522168122AA454453MBAFCX1H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989532168123AA454454MBAFCX1H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536972246911AA509034MBAFCX6E02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:41:14 on Sat 18 Nov 117.