CBrugiaQ_1926


Sequence

>CBrugiaQ_1926 (3 EST) Length=412 CTGCTTATCGATTTCATGTTATTTGGTGAACAAAAGTTTATTTCACAAAACAAATGATTTCTCTTCAAAATGGCAACAAA AAAGAAGAAAAAGAGCAATAAAAATAATGACTGGTCGGATGATCTGGATATCAAAGCAGCAACTTTGAAACTATCTTCCG ATTCAGAGACTGATAACGTCAATGAGAGTGATGACAAAACAATGGTACCCATCTATAGAAAAGGTAAAAGTGGAGTATTC AGTATGCTTGCCGGACAAGATTCTGATGACGATAATACAGAAAACGAAGGCAGTATTAGTGAAAATTCTAACAAGGCAGA CGGAATTGAAGATAGCAAGCAAGGAAAAACGAATATGAAAGCAAGAGATAAACCTGATGAGGCAAAAGAGCTCTCTANGC AACAAACAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1926: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982991892904AA257337MB4SLM2G11T3Brugia malayi L4 JHU93SL-BmL4
9165451917165AA275517MBL2SK1H01T3Brugia malayi second stage larvae JHU96SL-BmL2
11888042289668AA542756MBL2SK3A05T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 17:47:57 on Fri 17 Nov 117.