CBrugiaQ_1938


Sequence

>CBrugiaQ_1938 (18 EST) Length=1683 GATTTTAAATCCCTTTTCCATTACCATTCACTGTTTTCCATNTCCATTCACTGGTATTTNTGCTCTATTACGCTGCTTGC AGTACTCCTTAAGTCCAGGTCTATCTTCCATTCGTTGATGATAAGCTTTTAAAAGTGGAAATTTATCCAAACAGTGCGGA TCCAGGATCTGATGAATGTCAAGTTCTTCGAAAAGGACGAAATCTACGTATGAAATCTTTTCTCCTAGAATGAAATTTTT TCCATCGTCTCGTGTAGCAAGCAACTTTTCAAATTTCGCCAGCTCTACTGGCAATATATCTTTTATGTAGGAATCCTTTT CAGTGTCATAAGCCTGGTAAATCATTTTCGTATATTTGGTGTGCAGATCACGGACGCCTTCACAGAACATATCAATATGT GTCGTTTCCAGTTCATTTCCACCATTTAAATTATGTTTGCGAGCAAGATGTCTCAGAATAGCACCGGACTGCACAATTTG ATGATCACCATCGTAAAGACAAGGTAGTTGTCCGAAATGAAAGTGTGATTTCATGGAAGGCCAATCACTTGCATTGATAC GATCGTCAGTAAACTTTATACCTTGATCAACCAGTACTAAACGAATTGGTTCAGCCAAGCCTCGGATAGGAAAATACGTC AGTTTATAACTCATTACTCAACGATGCAATTGTTCACCTCAAACATGTCCATAACATCCTGTACTGATAGTTTTACCGGC GGTTTTTTAGTCCTGAGCGCCACAAACATTTCAACAGCTCCTTAATGCTGAGAAAATAAAACACACACCACAACCACCTT GATTTTTTACTGGTAGTGCAGCTATTTTCTTTCTGTAATCAATAGAATTTGGTACAGAACTGGATAATTTTTTTCCCAAT TATTTTACTCATATTTCCTTCCACTTTTGCAGTCAAATTTGGATAATATCCGTGAAGTCTTTCTTTCTCTTCTTCGGTCC AATCGCTCATTTCGTTCAGATCTACTTTGTATGTTTCCAATCCTTTACTGTAACGCTGGTTATGTTCATCAATCATTTTC AAAGATTGTACAAATTTAAGTAATCGAATTGGTTCCGGAACAGATGGATCATGTTTTTTGCCCATTTTTTTCAGATATGT TTTATACTTCGAATAATGCTGCTGATACAAGGTATGAATTTTACCTGGTGTGTCATCATTATCCAGTTCATTAAGTGGAT TTGCATAAGTAAGCAAGAGAAAACTGGCTAAATGTAGAATAAAAAACGCCTTCATCAAGTTAGTTAACAATCGGTAAAAA TTTTTTTCTTCCTTCAAGGTTCGACCAGCAGAAATTGTCGTTTGCTCGTGCCGAATCGGCACGAGTTTGAGGTGAAAAAT AGTGCATTTCGGGTCTCATCTTCATCAAATGATACAATAAGCCGTGAATCATCAGGACATCTGGAAACTTCACCAGCTGC ATTTTTTGGTGCATCATTTGGTTTAACGCAACTACCGGGTGCTGTTAAACCGGAAAATTTAATGCCAACATTATCAGAGC GTCCGGTTGCACTGACAGCTATGTCGGATGCCGCAGCTGCTACAGCAGCTGCGGTAGCTTATGATTCTCGCATAATTGGT GCTACACCATATTATAATAGTGGTTATCCGAGTGCAAGTTATGCCGGAATGTACGCTGCTAGCGGAACACAAAATTATTA TCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_1938: (18 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425671164715N41117SWMFCA293SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4458731182890N44371SW3ICA1209SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5594811345302W51589AS4SLC819T3Brugia malayi L4 JHU93SL-BmL4
5594861345307W51594AS4SLC850T3Brugia malayi L4 JHU93SL-BmL4
6364311486196AA022414SWMFCA579SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722271537174AA051967SWMFCA425SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7092431613917AA074013SW3ICA1668SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8675991849829AA228258SWMFCA668SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8983631892968AA257492MBAFCZ0F2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9164521917072AA275437MB4SLY1E06T3Brugia malayi L4 JHU93SL-BmL4
10988332168003AA454334MBAFCX0D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11253702209438AA480740SWMFCA2109SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11536612246875AA508998MBAFCX6A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887632289627AA542715MB4SLY2D10T3Brugia malayi L4 JHU93SL-BmL4
12139222335004AA563539SWMFCA2503SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12213272345224AA570931SWMFCA2778SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13870482662988AA680983SWAMCA3207SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13946132675718AA688436SWAMCA3108SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:26:52 on Fri 24 Nov 117.