CBrugiaQ_1940


Sequence

>CBrugiaQ_1940 (3 EST) Length=506 GTTTGAGTGATCGTAATTTGATACTGGAATGGAGGAATGCAATTGGAACTAATTAGATATGTTCTCTGAACTGATCATTT CTTCTACATTGTTATTAAACGCTTTCACTGTTATAAATATCAAACTATCTAAAACAAATCATTTCGATTCCTTTGTAATT ATCGAAGGTGAAAACCGATCAGTTGCGGATCGTATAAGAGATTTTCTTCTGTCGTTACGTAGTTTTCGAGTATTCATCGC TTTGTGGAATATTTTCGTAATTTCCCTGATGTTTGTATTTTTCTCACACTGAAAAGTTTGTCAAGCATGCAGTCAATGAA TATCCACGATGCTGTTTCTGTGAATTCTACAGCTGGAGCATGCAACAAACCGAGAGAAATGAAAACATTTGGTGTGGACG TCCCGAACGGTTCATTGCGGTCAAAACCAAAACGGCCAGAAGATCTTCAGTTTGATTTCGATGTCACATTATCCACTTTG AGGGAACAAATGGCAGCAAAAGTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1940: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425531164701N41103SWMFCA274SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363761486141AA022359SWMFCA483SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6675001531510AA051804SWAMCA1431SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:22:40 on Sat 18 Nov 117.