CBrugiaQ_1946


Sequence

>CBrugiaQ_1946 (17 EST) Length=1069 CAAACCTTNNAAAAAAAAGTTAAAATNAAAGGGACATTAAAAAAAATNATNAANATTTTTAAANTAATAAAATTAATACC ACTATTATAAATATAAGNAATAATTNAAAACATAACCAAATNATTAAAAAAAAACAAAACAAAAACCTCATTAAAAGAAA ATATCCCCAGGCAATAACAATCAATTAAAAGAATCAGGAGAACCNATAACAACTATATCCCNAAAAATTAAGCAACCAAA AAAATGCGAACATAACCAAAAATTATACCCAAAAACCAAAATTAAAAAAAAAAATCCCTACAAAAATTCAATAAAACTAC AAAATAAGGTAATTTCTGCAAAGTTAAAAACCATAAAATAGATCAACCCTTTAAATTTGACAAAACACTAAACAATCAAA AATGAAAAGGAGCAGATCCAGACTTCAATATAAGNAAAAAAAACTGAAATTTCCAACTATCAAAAACCAAAAAATAATAA CCACAAACCTCCTGAATAACATAATAATTAACTAAACAAGAAGTTCTACCACCACCAATTGTTAAAAAAACAAAAACAAA AGTGCAGATAACAAAAACTCTCCATCAAACAATATAGTCCAACACACAAAAATTAATAAAACTTAAAAACAACCTCGTGC CGAATTCGGCACGAGTNTGAGGTATGGCAGATTTAGAAGCAAAATTATTGGATTGTGATACAGCTGGTTACTGTAGTAGT AGTAGTGGTAGTGATAATGATGATGATATAAAAATTGATAAGCGGAACAACGTCTTGCAAAGACCTGAAATGGGAACAAA GCAGATAGTGTCAAGAAATTATCGCAATACAGGACCAAAAGGTGTATTAGATGATTATAAAATTTGTAAAGCAAAACTTG AAGAGAAAGAATTAAAAAAATATAAACAGATTGTTGCTCAAGCCAAAATATGTACTTTATCAGGAGAGTTTGCAAAATGA TAATTTGGAAGAAATTCCGAAGAAAGACGATTATTAGAAATGAAAGATTCCTTTATATGCCCATGAGAAAAATAGAATGA ATTAACAGAAAAGGAGCCGTTCCCTATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1946: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
309250924251H48199SW3ICA288SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320226945427R86441SWAMCA348SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
343566973970R95240SW3ICA404SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3658001019973H64212RRAMCA006SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4809801236217N74818RRAMCA1089SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5931111397381W84924SWAMCA1075SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806871547250AA054916SWAMCA1505SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6826861549514AA056875SWMFCA882SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7272561634901AA089422SW3ICA1792SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7484431662314AA110557SW3ICA1719SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7620991681967AA123672SW3ICA1900SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390321795697AA199954SW3ICA1989SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8948841888309AA253961SWAMCA674SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9214841923335AA280474SWMFCA2023SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9351011941913AA293900SW3ICA2753SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10797542140374AA435460SWAMCA1593SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987742167944AA454275RRAMCA419SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:44:41 on Thu 23 Nov 117.