CBrugiaQ_1947


Sequence

>CBrugiaQ_1947 (8 EST) Length=1060 NGGTTTGGGAGTTAGTGTATATTAATGCATGGGGTGCGAAAGAAGTTTCCGGGCTTGTTAACATGGGTGGAGAGCGCAAA TTAAAACTGGGAAATTTAACAGCAATTGAGAAACTTTCGTTGACAATTAAAATGTATCACCGATTGATTCTGCTGGCATT AGTTGGCACTACTATGGCAAATGTTATTCCTTTCTCTATGAGTAATATTCCGGAAGAATATAAAGAATTTATACCTGAAG AAGTGAGGAATTTCTACAAAGATTTGACAGTGGAAGATAAAGAAATTCTTCGTGAATTAGCAAGCAAACATGCGACGTTT GCAAATGAAGATGCTGCACTGGAAGCGCTTAAAGACAAGTCCGATAAACTTTACAAAAACGCAGTGGAACTACGAAATTT CGTCAAAGCAAAAATTGACAGCTTAAAGCCAGATGCTAAAATATTTGTCGATGAGATAATCGCCAAGGCACGATCATTGC GATCAGACGAACGGGCACAAGCTTGATACCAGAAAAAAATTAAACAAGCAGCCCCGAGATATCATTGCTAAATATCAAGC ACTCCAGTTGAAGAAACTAAGGAAGAACTGAAAGTTGACATTCCCCTGCCATCGCCAAAATCATTGGCAACGAAANACTC AAAAGGATCGCGAGTACCTTTTTACAAAAGAATTAGAGAAGTTTGGCCATCGAAACATTAATAATGTATTCGTTACCTTC TGTTGTATTCTACACCTATTCGGAAAAACAATTTTGGGGTAAAACAGAGGCATTGTTAGAAATTAATTAAATTGTTGAAT TCTAAGAACTCATGACCGAACTTCCCTTTATGACCAACATAGTAACGCAAGTAGAAATCATTCAGATTATCACCTGACAT CCTCAAACGTGGGTAATGTAAACCCGGAATTCCGGGTTTAATTACCCAAGTTTGACGACAGTATGTCACGACCTAAAGGG GGCGGGGGGGGACAATTGGTGGAGGTAATACAGGAGGAATTGTCATGGAGCTTTTTGCTGATATTGTACCTAAAACGGCT GAAAATTTTCGCTGTCTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1947: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447741167671N43289SW3ICA758SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272231634868AA089389SW3ICA1595SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8810301871014AA241722MBL2SJ8F8T3Brugia malayi second stage larvae JHU96SL-BmL2
8811271871111AA241507MBL2SJ9H2T3Brugia malayi second stage larvae JHU96SL-BmL2
8987801893385AA257869MBL2SJ4E7T3Brugia malayi second stage larvae JHU96SL-BmL2
8987921893397AA257881MBL2SJ4G5T3Brugia malayi second stage larvae JHU96SL-BmL2
8987951893400AA257884MBL2SJ4G8T3Brugia malayi second stage larvae JHU96SL-BmL2
10751172113594AA430772RRAMCA1514SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 10:36:57 on Sat 18 Nov 117.