CBrugiaQ_195


Sequence

>CBrugiaQ_195 (4 EST) Length=723 AATCAGAATATAGTTATTTCCACAGTTTTTTTATAAGGAATAGGGAAATTCGTTCATTCAAAACAAAACAGGGGATGTAG TTCANGGGAGCACGTANGCATCAGGCANACGTTTATGGAGNATGGAGTGCNTAATAAACNGAATAGGNACACCTGGNATT TTACGAATCCGTCGTTTCAAATCCTNGTAACATGTGGCAACCATATAACATTTATGCTGCGTAACCCTTTGTATAATACA GTNGTCGGCGTAAATCCCCTTATGAGAGCATGACAAACGTTTAAACCGATTATCTTTAATAATTTTTAGAGCAACTTTGC ATCGCTGTCCAAGTTTTTCCAGTTCACCCAAAACGCAGTCTGTTAACATACGGTATCGTTTTCGCATACAAACAGTCCAT AAATCCTTGCATAATATCGATCCTATACTTAATAGAGAAATTGACAAAATTCGTATCGATGATTACATGAAATGGTGGTC CAAGCTGGGTGTTGTACTTCAAGAACATCGCTGTTGATACTTGAGGTGCTTCGACAACTTTCAACGCCTGCTTATCATCT TTATTTTTCTTCCTGATAACGCGATCACTTTCCTTAATTCGCGAATCGGTTGGCTTGATCATTTTTGCTATTTTCGTGGA AATTTTCTGAGTTTTCTCTTGAGCTTACCCATATCTTTTCTATCTAACTGATTGCACACTATCCCTGATTAATTCACACT CAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_195: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9100041906069AA269001SWMFCA1737SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11535992246813AA508936MBAFCW1D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12139472335029AA563564SWMFCA2549SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12707272405708AA592045SWAMCA1839SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 3:57:51 on Sun 19 Nov 117.