CBrugiaQ_1950


Sequence

>CBrugiaQ_1950 (3 EST) Length=412 GATTCGGTAGGTCTCATCTATGCAGGCATTATCATAGTTGGCGGTTTCGTTGGTTACTTGAAAGCAGGCAGNACCGCATC GCTGGCAGCTGGACTTGTNGGGGGAGGTATTGCAGGTGTTGGTGATCAATCCAACAACAACTCCATCCTTTTAGCCGCTA GTCCTAGGCCTTACACTGATAATGGGCGCTCGTNTAATCCAGTCTGGTAAAGTTATGCCTTGCTGGAATAGCTGCAACGC CNGAGCCTTGGCATGATAATTCGATGCCTAGTGCGTTATATCCACTGAACGAGATTGCTGACAATGCATCTTCTAGATAA ATCCTAATTCTACAAAGAATTATGGAGCTCCCATGATTCGACACAACTTGCCATCAAGAGATACAATTATCGCAATGCCC ATTCTCCCTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_1950: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4459361182953N44434SW3ICA1291SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5014791267000N94655RRAMCA1200SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304241300174W23320SW3ICA1449SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:18:48 on Sun 19 Nov 117.