CBrugiaQ_1971


Sequence

>CBrugiaQ_1971 (6 EST) Length=408 GCAGAAAGAATGAAGCTTCTAGTAGCTCTTGCTTTGTTCTTCTTATCAGTTTTTGTGTTATCGAGCCCAGTACCTAGGCC AGATGAGGCTGAAATAACACAATCAGCAACCGAGAAGGAGGAAGTCCCGATTGCCAAGACAGAACACAAAGATTCAAAAA AAGTTGGCAAAGAAGAAGTGAAAGAAGAAAAGAAACACTTAAAATCAGAAGAAGCGTCAAAGGACACATCCAAAGAAGCA AAGGGAACTGAAGAATCAAAATCAGAACATTCAAAAAAGGAATCGGAAGGCGAAAAGTCGGACTCAGCATCAATGGAAAC ATCCAAACAGGGTGAGAAAGAATCGAAAACAAAAGAAGATGAAGTTAAGGAGGATCAGATAAGTGAGATAGAAAAAACTT CAGAGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1971: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281842890026H21331AS3ISB269SLBrugia malayi infective L3 JHU93SL-BmL3
8808341870818AA241500MBL2SJ0B9T3Brugia malayi second stage larvae JHU96SL-BmL2
8809111870895AA241603MBL2SJ2A11T3Brugia malayi second stage larvae JHU96SL-BmL2
8810111870995AA241586MBL2SJ8D12T3Brugia malayi second stage larvae JHU96SL-BmL2
8986961893301AA257526MBL2SJ3E4T3Brugia malayi second stage larvae JHU96SL-BmL2
11888162289680AA542768MBL2SK3C03T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 3:53:36 on Sun 19 Nov 117.