CBrugiaQ_1976


Sequence

>CBrugiaQ_1976 (31 EST) Length=1188 GCTTAAATTTCTTTATGGATATATGAGAGTACGACATTCATTGAAAACTGATATTTAGTATCTTTCACAACAGACATATT ACTCAATAAATTTTTCAAGGAGAGCAGGATTTGTTCCTTCTTTATCTTCTTTCCGTAACAAATTCCCAGCGACAATACCA GTAAATAAAATACGCATACCAAGCCACTGAGGTAGCGTGTATCAAGCTCCTTCTCAGGAGTAGAACCCTTAATATCCGAT ACCCGTTACAACCATGGTAGGCACATAAACTACCATCGAAAGTTGATAAGGCAGACACTTGATAGATACGATCGCCGGTA CAAGACCATGCGATCAGCCATAGCATATTCAGAGTCACCAATTAACGGATTAAAATTAATAATCCGATTGGTTGTGATAC TAATACCGAATGCGGCACGAGTAAAATTCTGATACGACTCACTATAGGGNGATTTGGGTACCGGGCCCCCCTTCGAGGTC GACGGTATCGATAAGATGGATATCGAATTCTTCAAAGTTGTTATTCATAGCATCAATGAAGACATAATGATTCTCCAAAT CCTGAAACATATACCAGACGAATGCTAAGCCAAAAGCAAATCGCTTTCCAAAGTATGATGAATGCCATGCATCATACATG CGGCCGGAAAGTTTTCCCCATAGTGAGCTCTGTTCCCAGTCCTGTTTTCTGAAACGTGGTCTGTAAATTGGTTCTTCGAT GAATGTGGTACATTTGGATCTGAATGGTACCACCAGTTGTTTCACCGGTAATTTGTTGCAAAGCGAGCGTTGAGCTACAG TTGTTGTTGTCTTTGCGATGCACATTGTTCACTATTTTACAGATAATTTAAATCCTGGTTAACTGTCCAACCAAACTCTC AAACTTGGGTAACTAGTTCTCGCTCGCTCGAATCTCGCCACGAGCNGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CTCGTGCCAAATTCGCCACAGAGAGTTTTTTGTTGTTGTGTGTTTTCTCTTATAAATTATATTTTTAACTTTTTATTGTA GGTTATTTCACTTACTTATATTTCTGTGTATTATTAAATTTAAAAGAATGCACATTGCATTAATTCTGTTATTTTCTCAC ACGCGTTTCCTTCCCTTCACATATATATATACATCTATATCTCTGTAGTGTCATAAACATTTTATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_1976: (31 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435306
1435318
296596905400H35917SWAMCA017SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
296597905401H35918SWAMCA066SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
300003914372H39291SWAMCA288SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4445451167346N43044SW3ICA1040SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4449111172293N43410AS4SLC530T3Brugia malayi L4 JHU93SL-BmL4
4449201172302N43419AS4SLC522T3Brugia malayi L4 JHU93SL-BmL4
4449431172325N43442AS4SLC579T3Brugia malayi L4 JHU93SL-BmL4
5221101289182W15142SWAMCA602SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594391345260W51547AS4SLC626T3Brugia malayi L4 JHU93SL-BmL4
5594431345264W51551AS4SLC642T3Brugia malayi L4 JHU93SL-BmL4
5595401345361W51514AS4SLC947T3Brugia malayi L4 JHU93SL-BmL4
5930981397368W84911SWAMCA1028SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6001211420959W91845RRAMCA202SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7062161592634AA072533MB4SLD053T3Brugia malayi L4 JHU93SL-BmL4
7062211592639AA072538MB4SLD059T3Brugia malayi L4 JHU93SL-BmL4
7062301592648AA072547MB4SLD060T3Brugia malayi L4 JHU93SL-BmL4
7566691675186AA118245KJ4SLB106T3JHU93SL-BmL4 (JHU)
7619521681820AA123649MBAFCE7B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002541737637AA161601MBAFCF7B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8558011817204AA216500AS4SLC713T3Brugia malayi L4 JHU93SL-BmL4
8855281876932AA246124SWMFCA1588SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10312382042874AA389888KJ4SLB323T3JHU93SL-BmL4 (JHU)
10483202064967AA406702MBAFCZ7E03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10614412078591AA417420RRAMCA1405SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11160142199155AA471391MBAFCX2A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539472247161AA509284MBAFCX9E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887502289614AA542702MB4SLY2C07T3Brugia malayi L4 JHU93SL-BmL4
11887592289623AA542711MB4SLY2D05T3Brugia malayi L4 JHU93SL-BmL4
13668772605415AA661371MBAFCW3C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:45:23 on Tue 21 Nov 117.