CBrugiaQ_1978


Sequence

>CBrugiaQ_1978 (2 EST) Length=393 ACCCAAGTTTGAGGATTGGAACATTGTTACGGTAATTTGTGCAAGATTCTGCTATCATTGCTGTTACTTTTTCTTACTAC CACTTTCATCTCTTGCTACTATTGGAGGACAAAAATATAGGCGTAAAGAGGCGGAAAAGGTTTGTAAAGTGGAAAAGGAC AAAATAGGACGAACTACAATCGACCATCTACCATTCAATTTATTGGTGACGGTTCATTTAAACGAGAAATGGGCAATAAA TGTAAATGAGCCGTATTTTGTTGGACAGTCCAAAATAGCTCTTCAATAACCTTCCAAGACGTCAACTAACATTTACCCAA GTATTAATTCTTCAATTCAATCATCCAATCTTTCACATTTTTTCCACTATTAACAAACAACAATCACNAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_1978: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5593991345220W51518AS4SLC461T3Brugia malayi L4 JHU93SL-BmL4
9246671927237AA283579SW3ICA2734SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:18:42 on Sun 19 Nov 117.