CBrugiaQ_1982


Sequence

>CBrugiaQ_1982 (3 EST) Length=655 GGAATAATTCACTCAGTGAAGGTTGTTTGTTCGTAGAATCCTTAGATCCTTTTTTCTCAGGAAGATGCGACTTCGAATTG ATTTTCATATGCTCTTTATCTCTCACCTTATCACTTCCTTGAGTTCGCGACCGCACTTTATCCATTTCTAACGTGGTATT ACCAAGAAGTGAACTAGACGTTGGCGGTTTTGTTGTGCTAGGTGCGGAAGAGACTGAGGTTTGTTTCGAACTAACAGCGG AATGTGACGCAGGAGGTGGAGGAGTAGACGGTTTTGTTGTAGTCCTCCAGGATGAAGATTGCGTACTGCTCTGGGGACCA GCGCTACGGGCCAGTGGTTGAACAGTAGACATGCATGATGATGCTGGATCAAATTGGGATGTGCTATTACATATCAGTGG AGGTGGCGGAGGCGGAGCTGAGATCAGAGAAGCACCAACAAAAACAGACTTGCATGTTGTCAAAGACAGTGTCGGAGGTA CCGGAGGTTGCGGAAGCGGTGGAGGTGGAATACTGAAATCTGGAGGATAAGCAANACGAGACGCAGCTGCCGACGAAGGT GTCTGANNACTNCCCTGTGTAATGCTCGGTGGCAGGNTAGGCNTGGNTAANTTGAGCGCCGGAAAACTGTGGTGANGGAA GTTTGCAGGAAGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_1982: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350193988824H48983SWMFCA030SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7472721660882AA109412MBAFCE1F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483032064950AA406958MBAFCZ7C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:26:24 on Fri 17 Nov 117.