CBrugiaQ_1994


Sequence

>CBrugiaQ_1994 (3 EST) Length=441 ATGAGCATAAACTCGAAATAGACGTTTCACAACCGCTTGTGCGATATGCAAGAAGTTNGGCGGGAAAGGCTGTCCAATCT GAGACGGGAAGATAGTCTTGTCATCTAGTTGCTCGTGCACCCAAGTCATCAAATAATCGATATACATAGGTGCTGGACAT GCAACTGTTTTTATCCCATCCGACCAAACGTACTCATATCTCGAACCCGCAAACATCCTAGGGCAAGATTCCTTCGTACA GTGATCACTTATTGTCCCAAACAACATACTCACTTGGTTGAAAAAGTCCAGAACATTTACAGCGATCCATTCGTTAGGAT CTTCACCCTGTGGCAATTTTACAGCTTCACGCAGATTCCCACTCCCCAAAGTCGCTGATGCATACCTCAGCAATTCGTTC TGTTTATCTACATGACGCAATCGATGCATTAGCGCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_1994: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164081917028AA275543MB4SLY1A04T3Brugia malayi L4 JHU93SL-BmL4
11162682199409AA471645MBAFCX4H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813442655464AA675758MBAFCW4D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:43:10 on Sun 19 Nov 117.