CBrugiaQ_2


Sequence

>CBrugiaQ_2 (6 EST) Length=801 GTTTGACGGAAATGCATGTTGAATCATGAGTTCATGATAGATAGCCACTGTTCACTGCAATTTATGCACGCCATAGTCGA ATGCCTGGCTGTACATTACTAAGCACCGCTATCCGTCGTCAGTTTTCGACACTAATGAACGAAAAGCGTTCACTGATTGC TGTTTGTCAGTTAACGGCGACAAATGACTTGGAAGCTAATTTCGAAGTTGCGAAATGCATGATGAAGCGTGCTAAAGAGC GCAAGGCGAAGATGGTTTTCTTCCCGGAGTGTTTCGATTATGTCGGAGAAAGTCGTAACGAGATTGAAGCACTGGCTTTA AGTGAGAACGACGATTATATCAGTCGGTATCGAACTTGTGCCAAAGAATATGGACTTTGGCTCAGTTTGGGTTGGATTTC ACCAAAAGGATCCTGCTGGATTACGGAAACCTTTTAATACTCATATTATCGTGGATGACAGTGGGAAAAACTCGTGGTAT CTACAGGAAACTTCATCTCTTCGATTTAGATATCCCNGGGAAAGTGCGCCTAGTAGAAAGCGAATTTTCAAGTCGTNGGG GATGAAATTTCGAAGCCAGTTTGTNCACCTGTGGGAAATGTCGCCATGTCCAATTGGTTACCAATTGGCGGTTGGCTGAA ATTGGCATTATGGGTATCCTATGAAATGGAACCCCTGTTTTGAAATTACCCACCGGGTTTCNCCGGTTGAAACNGGGTGG TGCCCCCTGGGGAAATCTGGCTAAGGANAAAAACTGTCCAAACCCCNTGTTTTTNTTTTTGCTGCNGCTCAAANTGGNGA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255631141664N27316SWMFCA235SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4425171164665N41067SWMFCA301SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4445411167342N43040SW3ICA1036SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10988192167989AA454320MBAFCX0B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161622199303AA471539MBAFCX3F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12774232429565AA598372SWMFCA2934SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:57:34 on Mon 20 Nov 117.