CBrugiaQ_2001


Sequence

>CBrugiaQ_2001 (2 EST) Length=405 AACAAACTCTCCTTCAACATCTTCAGCAACAACAACCTCAATTCCAACAACTTATGCAACAACAACAACAACTTCTCCAA CAACTAAAGCAGAAGCAACCTTCACTTCAGCAGAATCTCCAAAAACAGCAGTCTATGTTTGAAAAACTTTTGAAAAGCAA CAGAATTCTTCTCCAAAATTGAAAGCCATAACTGGATTTGCTCCAGCACCAGAAATGAATGTTTCTCAAACAATCACAGC ATCTACAATAAATGATTTCTTGTTCTTGTGAGATTTTTTTTCTTTTGATGATTTCTATGTTTTCATTTTCTCTTTATCAG CATGTCAACACGCGGCAATTTATAATTTCTTTTTCAAAATTTTCATATAAACTTAATCAATGATTTCATGCTTCATCTAT TCCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2001: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985741893179AA257702MBAFCZ3A8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480552064702AA406736MBAFCZ3A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:38:23 on Fri 24 Nov 117.