CBrugiaQ_2003


Sequence

>CBrugiaQ_2003 (3 EST) Length=687 GCAAGAGTTGTATTTTCCTCACATGAAGAAAGCATTGAAAGTGCTTTGGAGAACGAATCTGTCCCAGAAATTAATTCACG TCGGTATGAACTCAATGATTCGACTGCTCGGAGTAGTTTGCTTAAGTTCTGTTCCATATCTTCCATTTGTTGTTGTGCAG CTTCAAACCAACGATCATTTTCATCCATATGGAAAGCCATTTTCGAAAAAACGTCACTAACAGTTTTGAATATTCGCTTA ACTCCTGGCACCAACTTAGAGCCACAGTAGAATTAGCTTTAGGTAATGGAAGCAGTCATTGTTAAAAAATCGCGAAAATC ACAATCAAGAACTAATTTCGGATGACGTGNTATGCGCCTGCAGAATCTCTGAAGACCTCTAGCGCGACGTTCAGCGAATT CATTGTTGGTATTATCGTCCACGGATGTATTCATTATTGTTTCGGGTAAGAGCGGCGATACTTTTATCAGGTGCTGCCGG CACTAAATAACCCTTGTAAAAATATTTGTCCACTAATTTTTCATGAAGACCAAGAAAATCACTGAATCGCCTCCAGACAA CGTATTCCCGATCTAAATAACCTTGCACGTTTCTGTGTTGCTGTCACAACTTTATANACAATATAAGCGCCCATCCCTTC TCCTTTCTTNTCGAACTGTTTAATAACAATTTCAATANGCGAATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2003: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6186401463741AA007736SWMFCA416SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364111486176AA022394SWMFCA527SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7620691681937AA123535MBAFCE9B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:4:36 on Wed 22 Nov 117.