CBrugiaQ_2004


Sequence

>CBrugiaQ_2004 (3 EST) Length=573 GGCATTTTCGGATGCTTTATTATCACCTCGGTTTGTATAACGCTTTCGCCAAGCAGCGTGACAGAACATTTGAACACTTC CGCTCCCCGTTTCGGTTGGACCAACGGGAAAGTTTTTCTGTTGGCGGATTTTCAATCTCCAACTTAAGTGACGAATCCAC TTTAGTAGATAAATTCATTCTTTCACAAATTGCCCGTAAAATATTTTCTAGCTTCATAAAAATTTCTACGATTTCCAAAT TTTGAAACCAGTGCTGTTCAGCCAACAGACCATGTTGTATCAGTAATGCTCGCCTTCTCCTTGATTCAGGACTACTTCTG TGGATGTCATCATTACCATCACCATCATCATCACCCTGAGCTACCTGGCGGTGAACGGTTTCGGTGACAAAATCTGCTTT ACTCATTGCGACCTTTCATCATCTCCTCGTAACGAATTCGGCACGAGAGTAGATTTGATGCTTTTTTTGCTCTTCATCAT GAAGATGTTTAAGATTTACGAAAGAAAATGCTACAAAAACAAGCAGAATATGAGGAACACCCCGAAATAATGCTACAAAA AATTTCACAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_2004: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5407021313880W32850RRAMCA1230SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7523301668314AA114470MBAFCE4G09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163272199468AA471704MBAFCX5F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:53:36 on Tue 21 Nov 117.