CBrugiaQ_2010


Sequence

>CBrugiaQ_2010 (2 EST) Length=644 GCTGTATTTGTGATGATGGGGCATGACCATGGACCAAAAATACCATCGTATACAGTATATGATAATTATCGTGAGATACC GAAACTACGAGCACATGAGGAAAGGCTAGCACGGATCGGTCTAAAAGATCCTTGGATAAGGAATTATTCATATTTGTTTA TGGGACGATTTGCTGGCGACTCCTGGGGTAGTTTTAAATATATGATTCGTGCTGGATGGAAGTTAGGATGTGGTGTTGCA GCTGCAGTAATAGCCGTTGAAGAATCATACATGTACTGGAAATATGGTCATACACATTGGCGAAAGAGAACATCATTATG AATCAGAATCAAGTTCTCTTCCATGTAATCATCTCAATTCTATATGTTGTTTAGACTAACTATAGTGTAATTTTAATATT TTCGCATTTGAAAGAAAAACAATTTAAATAATGCCGAAATTATTACGAAACAAATTTTATGCGTGCTTTGTATGATTATA GTTTGTGAACTCTTCAAGGTCTCTGAATCGTTAGAGGGACTTTTCTGGAAACCTGTAGGCCTTTTAATATGTAAATATCA CACTTTATGTTATAAAGCTTATGTCATATTGTACAGGTTTTGTCCACAAAGCGCTCTTATAATAGCAAAAAGCCCTTCCT TTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2010: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164471917067AA275432MB4SLY1E01T3Brugia malayi L4 JHU93SL-BmL4
10987682167938AA454269RRAMCA403SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:13:58 on Fri 24 Nov 117.