CBrugiaQ_2013


Sequence

>CBrugiaQ_2013 (2 EST) Length=404 GCCTTCATAATTTATTTCGCAACAAAAGAAACTTTTGGTAGTGCAGAAGAGAGCAAAAAGAAATGACCGACAGGAAAGCA GTGATCAAAAATGCTGACATGTCAGAAGAAATGCAGCAAGAAGCTATTGATTGTGCAACACAGGCTTTAGAGAAATATAA TATCGAGAAAGAAATAGCAGCGTATATAAAGAAAGAATTTGAAAAGAAATACAACCCAACATGGCACTGTATTGTTGGTC GAAATTTCGGGTCATACGTTACACACGAAACAAAACACTTCATCTACTTTTATTTGGGCCAAGTAGCAATACTTTTGTTT AAGAGTGGCTGATTTTCTTCTTGGTCTATATTCCTCTTTTTCTTCCAAATGTTACGATTTTCATTATTTAAATTAGTTTT GATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2013: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9164631917083AA275448MB4SLY1F05T3Brugia malayi L4 JHU93SL-BmL4
11888412289705AA542793MBL2SK3G01T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 6:7:40 on Thu 23 Nov 117.