CBrugiaQ_2014


Sequence

>CBrugiaQ_2014 (2 EST) Length=408 CGTTAACAATGCAAGAAATTTGTCCAGTCTTTGGTACAGTGCGCAAATTTCCCGGGAAATCACGTGTTAGGGTTACTAAC ACCATCACTACGGGCNANACAATTATATCGAGTTCCATTTAGTGTAACAGATGTGTTCAATGTAATCGGAATGCCGGTAT CCGTTAAGCAATTCACAATATGTGTTCCGGTTGATGTGCAAGTTTTATTGAAGTTTCTTTTACTGACCCACCATTCTCCA AAGCGATGCCCTTCACAATTAATATTTCGAATGATGTATTGTTTCTGCATCTGATACCCACCCGACGGCAATTTTACACA GTGGAATTTATTTCGACACCTTCCGGCGTTTGACATGCAACAACATCCGCTCGCCAAGATCCATTCAGATAAACGTGACA TTCGCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2014: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3658101019983H64222RRAMCA027SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304711300221W23367SWAMCA519SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:35:37 on Sat 25 Nov 117.