CBrugiaQ_2025


Sequence

>CBrugiaQ_2025 (12 EST) Length=645 GAGAATAGTTCGGCACGAGGTTTGAGGTAGTGTAAAAAATGGGCAAGGCGGAGCAGCTTGCTGAAATTAGGGAGAAAAAG GCGGCCAATCCAATGAGGGAGTTGAAGATTGAGAAATTATGCCTAAATATTTGTGTTGGTGAATCAGGTGATAGACTTAC ACGTGCTGCTAAGGTACTTGAACAACTGACTGGTCAAACACCGGTGTTTTCGAAAGCAAGATATACCGTACGATCATTTG GTATTCGTCGTAACGAGAAAATTGCTGTGCACTGTACCGTAAGGGGTCCGAAAGCTGAAGAAATCATTGAGCGTGGTTTG AAGGTGAAAGAATATGAATTATACCGAGAAAATTTCTCAGACACTGGAAACTTCGGTTTCGGAATACAGGAGCATATCGA TTTGGGAATTAAATATGACCCGTTGATTGGTATCTACGGCATGGACTTCTATGTTGTTCTTGGACGTGCTGGTCATAGAG TTGCGAAACGTANACTTGCCCGTGGACTTTTTGGACACNCACATCCGGTTGGGAAAAANGAANCCNTAAAATGGTTTCAG CAAATTTTGATGGCATTATCCTGCCNCCCAAAACCAAAANANTCCACTTGGGCNAGGCNTTGAAATAATTTGGGGTCTCC GCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2025: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
267075870790H07195SW3ICA284SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448161167713N43193SW3ICA912SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811771237147N74838SW3ICA1372SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5251751293881W18207SWAMCA654SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441831318077W36331RRAMCA1371SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801161382117W59903SWAMCA781SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6000611416484W91817SWAMCA1029SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7272201634865AA089386SW3ICA1592SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8808271870811AA241493MBL2SJ0B2T3Brugia malayi second stage larvae JHU96SL-BmL2
8855981877002AA246181SWMFCA1686SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10989152168085AA454416MBAFCX1D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887442289608AA542696MB4SLY2C01T3Brugia malayi L4 JHU93SL-BmL4


Date: 3:44:42 on Sat 18 Nov 117.