CBrugiaQ_2030


Sequence

>CBrugiaQ_2030 (2 EST) Length=472 GTTTGAGGAAATGGTGTGGTACCAAGCATGCACTGTCTCATTAACACTTCTTTTAATTGCTTCATTGGAAATGACATTAG CAGGTGATGCAAATGAAAGATTCATGAACTGCTGTAATCAGAAGAAAGACATCAACCATTGGTGTAAAATGAAGCTATGC ACATTCAATGCAACTTCTGAACAGGTCTTAGATACTTATCCTTGGGGCACAATATTTGGTAATACAATGGCGGATATATG GCAGTGTGCTGGCGCAGGCTACGATCATACGAAATGTTGTACAAAAAGCGGAGTGCCGCCAAATTGTCGAGCCTATTGTA ATGGTAAATCAATAAAAAACATTGAAGACCTTAGTTGTATTTATTACACCGATCCGATTCTGGCTTGTTTTAAAAAATAT TATGAAAGTAATACTTCTCCTGCAAAACTGAAAAATGAGTATCAGCGGTTTTGGATTTATCAGTNCTGATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_2030: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5065401271167N99757SWAMCA594SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614572078607AA417397RRAMCA1422SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:4:45 on Fri 24 Nov 117.