CBrugiaQ_2035


Sequence

>CBrugiaQ_2035 (2 EST) Length=719 CCGGTAGTTTTGGCAACAGACGTCCTCCTACGCCTAGTTGCCATTCGGTATGAACAAGCGGATTCCATTCAAGAACAGGA GGTGGTTTCTTCCCAGAAATTCCACTGCCAGTAGCTCCTCCACCTACGGTTATTTCAGGAACAACAGAAGCCTTAATACT TGTATGCAGTGAGCCAACCTGTTGACACTCTTGACTGCTTAGACCGATACTCCACTTTACATTGGCTACATCACATTCTC GAAGTATTTTACTTGGCACACTAACCCCTTGTGACAATCCAACCTCTGGTAGTGCGGTCTCTGATACCGGAAGTAAACGA TTGGCAAATGGAGAAAAGCGAAAACGTACCATCGATTCCAATCAAATGGTAACCTCAAACCTCGTGCCGAATTCGGCACG AGGTTTAACGATCTCAAATGAACACATTCCGACACCATCAGCAATCATTTATGATGATCAAATACCTATGCAGCATTATG AACGTGAGGAACACGTACGAGAAATGTATGATGATTATAAGTTGAGACGACGTCGAATGCAAATTCGATCCGAACATATG ACTCGTAGACGTAAGATCAAACGATCGCATAAACAAATGCTAACTGATCAACGTATAATTCGAGTTGTTCAAGCTAAAGA TAATATGAAACAAGCAGTTAAAATGGCTAAAGCAGCTGGAAAAGCTGTCGAATATAGAGGACCTCTCAATCGAGCTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2035: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8984041893009AA257279MBAFCZ1A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481822064829AA406850MBAFCZ5H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:2:1 on Mon 20 Nov 117.