CBrugiaQ_2037


Sequence

>CBrugiaQ_2037 (3 EST) Length=466 GCACCACCACAAGTGCGACCACAAGATGGTTTCCCAGCAATTCCACAAGTTGCCAAGTATTTGAAGTATCAGTTACGACA TGATTCAGTAACAACTTCTGTGCATACATCATTTCTGGCTGATGAACTGATGTTGCCTGAACGTAAAGCAGAGCGAACGA TCGTATTAGCCGAAAGGACGTCAACTCGATTCAACCTGAACCCGAACCAAGCTCCTCCACTTGTGTTTGCGCANGACAGC AAAGTAGGATAAGGAAGGGGGCATGAAGGATGACCACATTGGGGAATATTTGGACTGACATCTTGAACGCTCATNTTGAN TTTCCTTGTTATTGTTAGGTATTTANTTGTCAACCATCACACCAACACCACCACCACCACCAGAACACTGCCATTANCAT AAATACCAACCAACGATATTGCTGCATGAATATGTGGGCCGTTCAATAAAAATGAGTGCGAAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2037: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320251945452R86425SWAMCA402SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5061121270739N99324SWAMCA545SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13814572655577AA675871MBAFCW5G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:0:40 on Wed 22 Nov 117.