CBrugiaQ_2042


Sequence

>CBrugiaQ_2042 (4 EST) Length=421 TTTGTATTAACTTTGAAAAATATTCACATGTACTGCAGCTAATCATCACAAACTTATGAGGGCAGGTAACAGTAATAGAT AATGAAGAGGGTACTGAACAGGGAAGGTCCCATATCTTTGTATTTGTAACAATTTCTTTTTAAAAATATTAAAAAAAGGG CATAATAAGTGAGTAATAATGTGAAAGTGTAATCACTTTTCCAACGGATGATAATCAAGCAATTTGACAATTAAATCGAC ATGTGACAGAAGCATTCTTCGGCAACAGTAGCGGCGTAAATTTAATGCATCGAGAGCATCACCTTCCGAATATTCTGCTT GAAGTAATCCGAGATAAGCATCCCATTTGTTACCAATAACTTTACCACAAGTGAAGCAACGTATCGGTATAATCATTTTG CGCCTTCTCAGAACAGAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2042: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281201889958H21263AS3ISB170SLBrugia malayi infective L3 JHU93SL-BmL3
5477071322261W39850RRAMCA156SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9164091917029AA275544MB4SLY1A05T3Brugia malayi L4 JHU93SL-BmL4
13668332605371AA661327MB3D6V5F09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 4:26:56 on Fri 24 Nov 117.