CBrugiaQ_2052


Sequence

>CBrugiaQ_2052 (5 EST) Length=398 TCTAAAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGCAAGTTTGAGGTAAAAAACAATCGACGACAACAACG GAGATTACTTATCCAAGTAAAGTATTAAACGACGTGAATTACGAAAAACGACGNAATTCANCGGGTGGAGAAATACAACG GCAAGCACAATATGGTAGCAATAGAGGATGACGTACAAGCAAGCGACAGTTACGACACTCAACGACAATTCAAAGATCAA GAAGAAAAGGGGAAGAAACCAACAACAGTCAGCTCGACCAGTTCTACTGATAGTACAACCGAAGCGAAGAGAAGAAACGT GATAAAATTATAATTTAAGCGGGAAACAATTATATAAAAGAAATCGTCTCTTATCAAATAAAGGTTGAAATATTCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2052: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281844890028H21333AS3ISB336SLBrugia malayi infective L3 JHU93SL-BmL3
8809001870884AA241592MBL2SJ0H10T3Brugia malayi second stage larvae JHU96SL-BmL2
8809771870961AA241656MBL2SJ8A8T3Brugia malayi second stage larvae JHU96SL-BmL2
11160782199219AA471455MBAFCX2G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888082289672AA542760MBL2SK3A10T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 12:36:14 on Fri 17 Nov 117.