CBrugiaQ_206


Sequence

>CBrugiaQ_206 (2 EST) Length=1021 ATTAAACCTCCAAAATTTGGTTCTTTCCATCGATTTTGTACCACCCNAGGGGGTAAACTTCCCTTGGAGGATCCGGAATT TCACCCTTCCNAAAAGTTTTCATGGTTTCGGCATCGAGCAAAGGCTTTATTCCATTATTCTCGACAAACGAATGTGCGCT GCATGATAACTATAAAGCATTGCATTAGCGAAAATAAGTAAATCGGTGACAGTCGACAATAATCCACCACCTGCCCATTT GCCTGAATTGTCTACTTCTGGAACATTCTTTAATTTATGATCTTGATCCCGATAGTAATACCTAAAATAAACAATCTACA CAAGGTATTTCCAATTATTCAGTTATGTAGAAACTTAATTAAATAGAAACTACAAGCATTCCTGAGATGGGGTTTCCATT CATCTCATCATTCTAACTTACCTGCTGATTAATTCAATGATGTTTCCATATATTCCGAAATGTCAAATATTTATATTTCT TAATTCAAATAATCAAGCTGCTAATGAACCGAAACCAATGCAACACAAATCAATTTGAAAAAGCACAAAATACCTGGCTC TATTGGTGATAAGGGGACAGTTAAGATCGAGATATGAATGGTTCATTCCTAATTCACGGAATAAATTTGTTATTTGATCT ACATATCTTTCACTGGCTGCTTTTTCTAGTGCTGCACTGAGTAAAGTAAATCCGTGGGTTGTATACTGGAATTTACTTCC TGGTTCTGCTACTAATTCATCATGTTTGAAGATCTCCAGTGCATCTTTCACACACTCGTAATGAATATTGGAAAAGAACT CAGATTGATCTTGAACCTCAATACTTCGATGTCGCGTTAGATTACTTTTACTGTATTTCTCCTTATATTAAACGTCTATT TTATGTAATAAATTCTTCACATTACCATCAATTCCTGTTTCAACCGCTTTCCTCAGCTCTCTCACAAAGTCTTCTACGGT CGGCTCAACTGGCTGTAATATAAACGATAAGACTGAAAAAATTTGAGAAACTGGTCGCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_206: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8639471845395AA224614SWMFCA1042SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11537862247000AA509123MBAFCX7E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:8:18 on Mon 20 Nov 117.