CBrugiaQ_2062


Sequence

>CBrugiaQ_2062 (5 EST) Length=596 TGATAAAAATAAGGCACACAGCCAGAGCGCCAACTTGACAGTGGGATAATTACTAACAGAATAATTAAATTACTTCCACG ATGTCTTCCTACCGAACCTATCGATGATTCTTTCTCAACCAGATTTAATGGTTTGTGAATCAGCCACATTATCAGTGCTT TCTTCAATAGAACCGTGTAAGTATGCAAATGTATTGCAAAAATCTTCTTCGCAAGCACAAACCTCCTGCCATCCGTTCCA GTTGTGCTGACATTTTGCCAGATCTCTTGCATCACCTGCATTGCTACATAGCTGTTCCATATGTGCCTGACTATCTTCAC TGCGGAATCCAATCAAACACAACTCGCCTGTACAAATCAGCGAATCTTCACAGTTTTGTTTGTCGCAAAAGCATCTTACA GTACTTTGCGCTAACTGGTATCAGCTGTGAATGTACCAAAGCACACAAACAGAGCGAGCCGAATCACAGCACGAGCAATA ATCAACTTTTCTAGAAAACATCTGCTTCACTATGTTTTTGCCAGTAGTGATAGTAGCACATACTCGAGAGCAAAGCAGTA ACAAGGCCTACTCACCACCAAACCAATCCCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2062: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296565902920H35870SW3ICA202SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7473571660967AA109471MBAFCE2G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986061893211AA257643MBAFCZ3D8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986271893232AA257729MBAFCZ3F9T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652342402605AA588942KJ4SLE034T3JHU93SL-BmL4 (JHU)


Date: 15:57:52 on Tue 21 Nov 117.