CBrugiaQ_2065


Sequence

>CBrugiaQ_2065 (2 EST) Length=448 ATTATGTCGTCCTTCATTAACTTTCCAAAACGTCTTAAGCCTGTGTCGTGGTACTTTGCCATACGTTGTGGATCATCGTC CACACTCGCACCGGGCCGTATTTATTCGCAGAGACACTTATTTGAAGTGAAAAAGACCCAAATGAAGGCGAACAATCCCG AAAAATATGCATTAGCATCAGATTTCCTAGCGCACCGAGCTGATCGTCCAAAAGACTACAAGCCAGACACGTCTGCAGAT CGATCCATAACTCCTTCTCCACAAGAGAAAAGACTCCTGGTCCTAACTGGTATGTACAAACGTGATCAAGTTTTNCCCGG ATTTATTCAAGTGGAAGGTCCGTTTTGGAAATGATGAAGGAACGGCTTGAATTTANTTGGGATTCAACTTGGGTTTGGGG GGAANAATGGCCACCCNNTTNGGGGGGGAGGANAAANAAAATTTTTCN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2065: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343554973958R95228SW3ICA376SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448251167722N43324SW3ICA922SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:17:7 on Sat 18 Nov 117.