CBrugiaQ_2074


Sequence

>CBrugiaQ_2074 (7 EST) Length=391 TTTGGGNGGNAGAGAAATAACATTTTATTAATTACTTCATAAAATCAACAAAGATAAAACTTTCGACATATCATTTCTGA AGCATCTTCAAGCACAACAAAATCTCGTATTTTTTCAACCACTTTATCTACTTTCGCTTTACATGTCATAGTAGCAGTTG AATTATAAGCAAAATGGTCATCGCAGAAATCATCCATTTCCTGAGTGACCCAATCAAAAGCTTGTTCAATTACATTATTT ATTCCATTGATAAACATTTGACATGATTCACAAAGGCTTTCTTCCTGATTTTCAAGAGTAATCAGTTCTGATAATTTCAA TTCCTTCGTTTGACATGTCATCACAGCAACTACAAGTACCAGTGCAATTGAAATAGATTTCATTTTTTAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2074: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8640521845500AA224716SW3ICA2145SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8808491870833AA241515MBL2SJ0D2T3Brugia malayi second stage larvae JHU96SL-BmL2
8809651870949AA241644MBL2SJ2H2T3Brugia malayi second stage larvae JHU96SL-BmL2
8809881870972AA241680MBL2SJ8B10T3Brugia malayi second stage larvae JHU96SL-BmL2
9164951917115AA275534MBL2SK1A05T3Brugia malayi second stage larvae JHU96SL-BmL2
9165221917142AA275494MBL2SK1D10T3Brugia malayi second stage larvae JHU96SL-BmL2
9165361917156AA275508MBL2SK1F08T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 22:46:42 on Thu 23 Nov 117.