CBrugiaQ_2081


Sequence

>CBrugiaQ_2081 (2 EST) Length=399 GAGGTAATGTCACCGCTCATTGCTATCCTTTGTCTGATTACCCTACTTGTTGATAATCAAATGCTTCCATTTACGATTCA GCTACCATAACAAAAAAATCGGATTTATCAAGATAAAGTACAGCTTAANGAGACACAAACGATGAAAGGATCATTCTACA AGGATACTTTTANNCTGGAACAAAATTATTANTAGTGACCTACCANGGGGNAGAGTTGCCTTTGTNATCTTTAGTGATAT TTCCTATCTTTATNAACAGTATGTGATCGGNGCGATATCATCAATAGAGGNTTGCGGNTCTTCCTTGCGTAGTAGTAANT NTCCCNGCACCTGAGCTGGACTTATTTGTACATTCAGTGCTACCGCAGCGTGTCGAAATTTCATAGCCATCTCTTCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2081: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304611300211W23357SWAMCA506SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8987471893352AA257836MBL2SJ4B2T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 21:1:25 on Wed 22 Nov 117.