CBrugiaQ_2085


Sequence

>CBrugiaQ_2085 (17 EST) Length=399 AGCCAATAGCATCCATTTCATTCTCACCATCTAATGGTCCCTATCAGCTGCTTCATTAGTTACCCAAGTTTGAGGCAGTC ACAAGTGAATGTGCCTTAAAGCATCAAATGGATTCTCGTTAAGAGCACTTTAACAATTGCTGATGCAGTCGCGATACCGC TTCCGCCTCTAACACTCTCCCGTATTTTGGTGCAACGGCGATAGCGGTAGAAGCGGAAGAGCCTCATACGACATCCTCAC AATGAATTGCAAACTGGTGAACTGGTATTCTTTGCACTGATAGCCAAGAAATAAATAATATATGGCTTATTTCGAGCATC ACACTATAAAGTATTGTCGATTTACTTCATCACGCTATGATTTAATGATTTTTCAATTTTACTCCTTTGATTAGCTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2085: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435263
1435300
1435319
4449811172363N43480AS4SLC811T3Brugia malayi L4 JHU93SL-BmL4
4576451193282N52116KJ4SLB178T3JHU93SL-BmL4 (JHU)
5594271345248W51634AS4SLC607T3Brugia malayi L4 JHU93SL-BmL4
8196041763785AA180580MBAFCF7G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8982741892879AA257403MB4SLM2E5T3Brugia malayi L4 JHU93SL-BmL4
8982751892880AA257404MB4SLM2E6T3Brugia malayi L4 JHU93SL-BmL4
8982791892884AA257245MB4SLM2E12T3Brugia malayi L4 JHU93SL-BmL4
8985691893174AA257697MBAFCZ3A2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9101091906174AA269112KJ4SLB035T3JHU93SL-BmL4 (JHU)
10480502064697AA406731MBAFCZ3A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481182064765AA406656MBAFCZ4E04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887312289595AA542683MB4SLY2A09T3Brugia malayi L4 JHU93SL-BmL4
11887692289633AA542721MB4SLY2E07T3Brugia malayi L4 JHU93SL-BmL4
12617192392915AA585503SW3D9CA050SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 16:32:45 on Sun 19 Nov 117.