CBrugiaQ_2086


Sequence

>CBrugiaQ_2086 (10 EST) Length=1174 TTTCAAGTCAATATTTTATTGAGCACTTGCTACATAGTTAAATCTTTCGTTCATGAAATCAATTAATCCGCCGACCGAAT CATAAATACAATTTAATGGAATAAATTATCTGCTTCTGCCCGTGCCTTCTTAAATTTTTCGCGTTTGCAGCTTTTTCCTT TTCCTCCTTTTTTCGCTCTTTTCGACGCTTCTCCTCCAGGAAATACATTCGCAGTGCAAGGGCACGATTGCAGTGCGGTA GGTGCTGATGCGGATAGGAGAAGCATCGGCTGCATGAGGTGTCGGTTTCTCGGACGCACATTTCGGTTGGTTGTCCGATT CAGCCGGTACAACCTTAGAACGCCGTTTGTCTCGTCTACCCAGCTCATCCGCTCACTCTCGTGCCGAATTCGGCACGAGC TCGAAGTGCACAAAGGTCGGCNNGNGNTCGAAGCGCACAAAGACAACCTAACACACAATGGGTGACGCTCCAGCAGAGGG TGCACCACCACCAGAGGCTGCAGCACCACCAGCAGAAGGTGCACCATTAGCAGCAGGCGTACCGGCAGATGGAGGAGCTC CGCCGGAAGCTGCTCCGCCTCCGGCTGGACCACCGACGTTGAACATCGACCCACCAGCTGCTCAGGTACCTGCTGCAGGC GGACAGTCTGTACACCAAATCGCTAATCCAAGTGGTGTCCGCTTGGCCTTCAAGGTAAAGTCGACGAACAATAACGATTA CCGTCTGAAACCGGTCTATGGATTCGTCGAGCCGGGGGCAACAGCTCCATTGGAAATCACCCGTACAGCCGGACCACCGA AAGAGGATAAATTTGTCATTCAGTTCAAGGAAGCAGCTGCAGATGCTGCTGACCCCACGGCTATTTTCAAGGGGGGACCA CCGGTCGGGGAAGTTACCTTGCCTATCATGGCTCAATAAATATTCAGCGTTTTTCGCGGATACTCTCGACTACAACCTTT CTTCACCTACCTATCAACAAAGGATTATTTTTTTTCCTAAAAACTGATTTGGGATAAGTAGCTTCGATCCACTGAAATAA ATTTTTAACGACAAATCAATATCCATGCTTCAACATGTGGATAATGTGTATTGCCTGTGTAACTTTCGCGCTTGCTCCGA TCTGTGCTACTGTTACTGCACTGCCGTCATCCACGCATGTGATAAATGTATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2086: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304601300210W23356SWAMCA505SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801151382116W59902SWAMCA780SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801201382121W59907SWAMCA785SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5930951397365W84908SWAMCA1022SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6826051549433AA056773SWAMCA1541SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8195851763766AA180548MBAFCF7E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8948851888310AA253962SWAMCA677SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750882113565AA430883RRAMCA1479SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10751162113593AA430771RRAMCA1513SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774572125761AA433163RRAMCA1605SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:8:34 on Thu 23 Nov 117.