CBrugiaQ_2095


Sequence

>CBrugiaQ_2095 (2 EST) Length=490 ATTGCAGAACCCATTTCTGCGTATGTTTGCGAGANACCTTCTGGCTCAAAACACGAATCCCAACCGAAATTCGTCTCTCC CCTCGGTTTAACTACTCTTCCGTTCGTTCTTCCTTCGAAGAGGAGAACAGGTTGAGATGAATTTTCGCAATATGCAAATA TACATTGCGCATATGCGGTTTTATCTTCAAAACCAGCCAACAATTAGTACAGACCATCGGGTTTTAAGTTCTTGAGAAAC CACTTGATGTATGGCCCGGGTAAGCCTCCAAGAGCATTAAAACACAGACAAGTATCTTCAACTACAACAGCTCGCTGTAG CTGTTGTGAGGCTGTTAAACATTTAAGCCTAGCTATTTCAGACGGTTCTCCTTGATATTCCGGCAAATCGATGTCTTCAT TCTCAATCGTGAACCGATCTCCAAGGATAGCGCGCACTTCTCTCACTTTATTCACGTTCCCAGTAACGAATACCAACGTT CGCATAAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2095: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10989572168127AA454458MBAFCX1H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161362199277AA471513MBAFCX3D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:42:0 on Fri 24 Nov 117.