CBrugiaQ_210


Sequence

>CBrugiaQ_210 (4 EST) Length=655 GCAGATTTCCATGACTTGCATCACCAAGCCGATGCTGTGGTTGACATCCACGTTGAACTGGTTGGAGTGTGGAAGTACTA CATCATAGTAATGCTACAAAAAACATATAGTTGCTTGCAGCGAGTAATTTGTTCTATTTTCATCGTTCCAACCAGTCCAG TGTTGGTCCATTCATGTTATGTCCACCATCACAAAGAACGTCACAATCTGCGACTTTTTCTCGGTATTCAACGCTCAAAC AAGCATAAAGCCAACCGGAAATACACACATCAATGAACGAAAATTTTCTCGGCTTCGCGCTAAGAAGAATTTCAATATCG AATTGCCCGATGACGATATANAAACAAAGAGACAGAAGATGAGCCCACTGGATTTGCGACTCATTTTGTTGAAAAATAGG AATCAATCCATATAGAGATGTTTACACCCCAGACATGGAAAGAATTCCAAGTGACTTTCAACTCTTGTTATCAAGTTAAT GGATCCTTTTGTTCCCGAGAGAAGAATCTTCACCTAATGATCCCTACACTATTTTCGTAAAAATCCGTTGAAACTGTTAG GTTTCCTTTCCTACTACCTCCAGAANTTTCNCGAAAAGAAAGAAATCTNTGGAATACGCTCTATTGAGAGCATGATACAA GGACAATCCCGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_210: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8981001892705AA257177SWMFCA1463SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11539642247178AA509301MBAFCX9F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212832345180AA570887SWMFCA2655SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13860452660407AA680459SWAMCA3037SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:40:6 on Sun 19 Nov 117.