CBrugiaQ_2111


Sequence

>CBrugiaQ_2111 (2 EST) Length=531 CAAATGTTCACATCTTCTTGATTCAATTTTTAGCACTGCTAATTCCTCAAATTATTTGCTAAATTTTTGCATATTCTTTT ATGAGTAAAATTTATGTGTACACCGTATTTTTTTTAGCTTTCCTCATTGCTTCATGTAAAAAGCATTATTCCGTTTCTCC TCCTTTTGTTTCTTTAAAGCAAGGTGCAACATTTTGAGTGCTTCCTTAAGTTGCAGCTCTAGATTCTGAAACTTCCAAAA ATTCCATAAACCTTTATAGCTGTCCCAAGTCATTTGTATTGTGTGCTTGTAACTTCATTTTTGTTCTTAACTTTTACTTA TAACTATGCCGCTTGTTTCCGAGAATAATTCTCATCTCATATTTCCTTTAATTTGTTCTAATGTGCAAGAAGTCTTGAAA CTACATGAGGTGTTTTATTACATGTTTATTTTTCTCTCTTTTATATTGAAATATTCATTAGATTAAATTAAATTTTTTTT GGTTTTCAATATAATTACAACTCCTTTCGTGGATAAATGTTCATTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2111: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482092064856AA406877MBAFCZ6B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212722345169AA570876SWMFCA2637SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:35:22 on Sat 18 Nov 117.