CBrugiaQ_2114


Sequence

>CBrugiaQ_2114 (2 EST) Length=251 GAACATGCATCGATTGCTGTCAGTTAGCATACGCCAACTGCATATTCAAAGAATAATCACTCTGAAAGCAATTCGTTATT CCTCCAGAACTACTGCGCCACTCCGATGTAAGATTGAAATCGGGAAGGAGGCGAAAAGTTGGGTGGAGAAAGCAGCGAGA AAGATCGATCCCTCTTCCGCTGAACAAAATGACCCCANCACAACTTTCANNCATCATACTGGCTTNTCATGGCTTCGNNT TTATNCCCANT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2114: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217654808476R47589AS3ISA016SLBrugia malayi infective L3 JHU93SL-BmL3
4450621182089N43624SW3ICA778SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:45:10 on Thu 23 Nov 117.