CBrugiaQ_2124


Sequence

>CBrugiaQ_2124 (3 EST) Length=398 TGCAGGATTCGGCACGAGCGGCACGAGGGGAAAATGTCAAATAGAAAAACTGAATCAGCACCTTGTGCTATGCTTCCTGG AACAAGTAATTTAGGTATCGGAAATGTTATTCCAAGTGCACCATCGCCTCTAGTCGATGCTGACAGGCATGAGATATCCG AGGTTCCACATACCGGTAGCTTCTTAAAATTCTTCAACGCTAGTAGCGTGTTGAATATCTTTGGACGTGGCTTCTTGGCA GAACCTGTGCTACGTGATGAAGAAGAAAGCTATCGTTATCTGATGGCTGTAGATCGCTACTGAATGAGAAAGATTACAAC TTCTCATGTCTATTCATCATCGATGATTATAGTCGGACTTGCATAAAATCCTCTTCANTTCTTCTAGNTTCGGCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2124: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425441164692N41094SWMFCA264SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5014441266965N94684RRAMCA1154SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7523561668340AA114505MBAFCE5C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:54:17 on Thu 23 Nov 117.