CBrugiaQ_2135


Sequence

>CBrugiaQ_2135 (2 EST) Length=725 AATTACGCAAATTTTTAAATAACTTTTCAAGGAATAAACAACAATATGGCATGATAGTTACAAACAATAACTCGGGCTTA TACATTTTATCGTCTAAAAGACAAGAAAATTGGGCTGGAATAAAAAGATAAAATAGTTACTAATTGTAGTAGAAAATGAA TGTGACAGTTCTCGTTAGTGCATATAATCATTAGGTAAAACTGGTTCGAGTTAGCTTGGAAGCATTCCAGACAGCTGGAA TATAACAACTTCGATTTTATTATCAAGTGATTTCATTGATCTTGGGCTAACCTTTCTACTTTGTTAATGAAATAAATTTT TATGAAGTAACAAAATTACGATGCACTAAGCAATATTATATATTATGATTCGCTCGTGCCGAATTCGGCACGAGGTTTGA GATTTTTGGCCTCGTGATCCCGCTGAATATGCTGGTCGTCGTCATAAAGTGGTTGTCGAGAATTTAACCGTTCCTATGAA TACATGTAAACCGAAGAATAAAAATGAAGCTAGTGCAACTTCAAGTTTGTCCGACCAGAAGAGCATACTTTGTGGTTACC TTTTGATGCAACGAATTCACTGTGAACAGCAATGTCATCATGTAGTGATGAACAATTGGGGTAGAAGGACATTCGCGACA ACCATTATTTGGAAGTACGAGCGCAGTTTAATGTTTCCACCCTGAAAAAATCCAGGTTGGGAACAATTTGGGGGGGAAAT TTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2135: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5407041313882W32852RRAMCA1233SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8002321737615AA161689MBAFCF1G09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 1:18:16 on Tue 21 Nov 117.