CBrugiaQ_2165


Sequence

>CBrugiaQ_2165 (2 EST) Length=488 AATAATTAATTCTTTTANACAAATNAAATATTTATTGATAAGAGAATTTTAATATGATATCAAAATCATTCTGCTTTAAT GGGCAAAATTACTTCGCCTGCTTGCGCTCCAGCTTTAAATGGTGCCTGTGGATCATCTTCTTCGTCTGGTACCTCAGCCC ATTGAATGACAAATTTATCCTCTTTAGGTGGTCCTTCTAGACGAATTATTGTCAATTCTGTTTTGTCACCTTTTGAAACA AAACCATATACTGGTGTAACACGATAATGATCATTGTTGGTTGATTTCACTTTAAAACCAAGTCTGCCCTCGGTTTGATT GATTATAATAACAGTAGCGTTACCTCCAGATGCTTGGAATGTTACATCGGGAGGAGCGATAATCATTNCCATCCTAAATT ATAGTACCTNTGCAATATAATTTTGTTTATAAATGACTAAACGTACACACGTGAAATCGTTCGTACCGGTANACNNCGAA AAGCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2165: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320257945458R86431SWAMCA412SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750762113553AA430796RRAMCA1463SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 10:3:50 on Fri 24 Nov 117.