CBrugiaQ_2166


Sequence

>CBrugiaQ_2166 (55 EST) Length=1136 ATTTCTTTTTTTGGATTAGAAGATCTTTTCCAGGGCTGCAGGAATTNTTCTTCAGTTGGTTTTTTAAATTCTTTAATTTT TCTTCCTGCTAGTTTTAGTTTAAGTTATATATGAAATTTTGGGAGTATGTTGGGTATTATGTTAATATCCCAAATTATTA CTGGTTTTTTTTTAACTTTTTACTATACAGCTGGTGATGCTTTTAGTAAAGTTCAGTATATTATATTTGAAGTTAATTTG GGTTGGCTTGTTCGTATCATGCACTCTAACGGTGCTTCTATATTTTTTTTATTTATTTATTTACATATTTTTAAGGGATT AATTAATAGTAGCTACCGCCTCTCTAGTGTTTGAATTAGTGGTATCGCTATGTATTTAGTTTTAATAGGCATTGCATTTA CTGGGTATGTTTTAATTTGGGGTCAAATAAAATATTGAGCAGCGGTTGTTATTACTAGTCTGATAACTTCTGTACCTTAT TTAGGTAAGTATATAGTATGGTGAATTTGGGGGAAATTTAATGTTTGTGAAAATACCTTGAAATTTTTTTATTCTATCAT TTCATTTTCCTTGGTTGTTGTTGGTCATGGTTATTTTTCATTTATTTTTTTTACATTTTACTGGGTCTAGTTCTAGGTTA TATTGTCATGGCGATTATGATAAGATTCATTTTTTTCCTAGTTATTGATTTAAGGACGGTTTTGATATTTTTTTTTATTT TTTTTTAGTTTTATTTAGTTTGTATTTTTCTTTTAATTTAAGTGATCCAATAATTTTTGTTGAGTCTGATTCAATAGCTA GACCAGCCCATGTGGTCCCTGAATGATATTTTTTGTTTGCTTTTACTATTTTACGTTCTGTGCCTAATAAATTGTTTGGT GTTGTTTTAATGTTTGGGTCTATTTTTGTTTTATTGGTTTTTATTTGATTTAATAATTATCAAGCTATGATGGACAATAT TTTATATTTTTTATCTATATGTTTTGTTTGGGTTTTTTTTTGGTTGACTTGGGCCGGTCATTATCCCACTGATTATCCAT TTANTTATTTTAATTTGATTTGTACTATTTTTTATTTTATTTTTATTTTTTTTATATGTTTTGTTAATTTTTTAAGTTTT AAATTATTTAGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2166: (55 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291564902096H30940SW3ICA183SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291616902148H30992SW3ICA246SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
296607905411H35907SWAMCA175SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
3657981019971H64210RRAMCA003SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4123801122560H98338SW3ICA564SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4411361162906N39686SWMFCA260SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4425221164670N41072SWMFCA297SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4427421164890N41292SW3ICA1015SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447631167660N43278SW3ICA715SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811881237158N74849SW3ICA1416SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5014631266984N94639RRAMCA1176SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6001301420968W91854RRAMCA216SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6378781488477AA023861SWAMCA1050SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7155531619224AA080315SW3ICA1562SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7159211620778AA080683RRAMCA225SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7159371620794AA080699RRAMCA269SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7471991660809AA109313MBAFCE0G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7496721663676AA111786SW3ICA1877SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7523171668301AA114405MBAFCE4C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001311737514AA161721MBAFCE8G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001401737523AA161730MBAFCE8H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001521737535AA161703MBAFCE9E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8640361845484AA224700SW3ICA2068SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640681845516AA224732SW3ICA2181SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679721850737AA228631RRAMCA401SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8854651876869AA246061SWMFCA1167SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8854851876889AA246055SWMFCA1220SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855671876971AA246163SWMFCA1646SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855941876998AA246177SWMFCA1680SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8963181889998AA255395SW3ICA2435SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963281890008AA255405SW3ICA2445SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8985611893166AA257689MBAFCZ2H6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9076521902757AA266669SW3ICA2355SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141351912505AA273131SW3ICA2109SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141661912536AA273162SW3ICA2589SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245631926165AA283471SW3ICA2022SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246771927247AA283589SW3ICA2747SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10480422064689AA406723MBAFCZ2H06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483372064984AA406901MBAFCZ7F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161922199333AA471569MBAFCX4A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162362199377AA471613MBAFCX4E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162562199397AA471633MBAFCX4G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163502199491AA471727MBAFCX5H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11253632209431AA480733SWMFCA2094SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11536572246871AA508994MBAFCX6A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537152246929AA509052MBAFCX6F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538922247106AA509229MBAFCX8H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539342247148AA509271MBAFCX9C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11587972252974AA514157SWMFCA2272SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11938942315046AA547845MB3D6V1G06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12212212344715AA570825SWMFCA2576SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354912369586AA585033SWMFCA2875SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247532539396AA627009MBAFCW2D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814372655557AA675851MBAFCW5E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870902663030AA681025SW3ICA2702SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:53:33 on Tue 21 Nov 117.