CBrugiaQ_217


Sequence

>CBrugiaQ_217 (7 EST) Length=767 AAAAATACGACGAAGACGACCGAACGAAGACGCGCATTCATCGACATCATTAACGCGTTATCACTTGTTATCATTGTGTT ATCACTTATTCATTATCATTTTCTCTCTTGTCAATATTACTGGTATTGATACCGTAAATGGGGGGCGAACCTACTGAATT TCTCACCTAATAAAACAAGCAGTTTTAATTTCCCACGATGAATACATCGACTTATTCATACGAAGCAACGCCATTTTCAA ACGATTGGTTCAATGCGAAACATATGGGCCAACAATCTGAGCACCTTTCTGTTGAGCAATTGCTCAGGNTGATGAATCAA ATAAATGCATCAGTAAAAGGTGGACTATTTAACGCTCAACTTGCTAATCAGATGTTTGTTCTTTGTCAGCAACTCAAATT TTCTGGACAACTTCTCGAGCAATCTCATAAAAATGAACTGAATCGAGTTTTCGTTTCTTTGCGACAAGCTTGTTGTCGTG ATAATGGTCAACTTGGGACGCCGTGTCGACTCAAAATGATGGAATTGGTAGAATTACGAGCAATGGGTTGGAGACCAAGC CTAGCACATACACANTATTATCTTAATCGTCCTGAACAACANCAGCANCAANTTGATCCTGCACCAATAAGTGCTCCACC ATTCGGTACAATCCCGGTAAATCCGGTGGGTAATGTTGGCGGTCCTTCACCACCACTTTATGTTGGAAATGATGTAAACA ATGCAGTAATCACTCCACAACCCACACCAGCAAGTTTCTATCTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_217: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3795521054518H77267SW3ICA482SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4156301122574H98352SW3ICA503SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450551182082N43617SW3ICA771SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452041182231N43703SW3ICA735SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7272111634856AA089377SW3ICA1581SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390501795715AA199972SW3ICA2019SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13247352539378AA626991MBAFCW2C04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:30:17 on Sat 18 Nov 117.